Proceedings of the 2nd International Conference on Smart and Innovative Agriculture (ICoSIA 2021)

<Previous Article In Volume
Next Article In Volume>

Genetic Diversity of the Prolactin Gene in Three Indonesian Ducks

Authors
Aprilianna Putri Zahara Nafsina Luvita Sari1, Akhmad Fathoni1, Heru Sasongko1, Dwi Nur Happy Hariyono2, Dewi Sari Kumalawati1, Dyah Maharani1, *
1Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia
2Faculty of Agriculture, Universitas Khairun, Ternate 97719, Indonesia
*Corresponding author. Email: d.maharani@ugm.ac.id
Corresponding Author
Dyah Maharani
Available Online 10 March 2022.
DOI
10.2991/absr.k.220305.054How to use a DOI?
Keywords
Prolactin gene; Genetic; Polymorphism; Indonesian; Ducks
Abstract

The Prolactin gene is a candidate gene associated with egg production due to its crucial role in the production and reproduction of poultry. This study aimed to identify the polymorphisms of the prolactin gene in Indonesian local duck breeds. For that purpose, three duck breeds, namely Bayang (n= 25), Turi (n= 26), and Magelang (n= 14), were used for genotyping of the prolactin gene using polymerase chain reaction (PCR) amplification and direct sequencing method. The primers used were primer forward: 5’- TGCAAACCATAAAAGAAAAGA–3’ and reverse: 5’– CAATGAAAAGTGGCAAAGCAA–3’. Two single nucleotide polymorphisms (SNPs) in intron 4 of the prolactin gene were detected: C5796A and T5817C. The frequencies of the 5796C (0.85) and 5817T (0.85) alleles were highest in the total population. For the C5796A locus, the CC genotype had the highest frequency (0.69), followed by CA (0.31), without AA genotype. For the T5817C, the TT genotype had the highest frequency (0.69), followed by TC (0.31), without CC genotype. The genotype frequency distributions in all breeds at every locus were in Hardy-Weinberg equilibrium (P > 0.05). Future studies could further expand the effect of the SNPs in the prolactin gene on economically essential traits, especially egg production in ducks.

Copyright
© 2022 The Authors. Published by Atlantis Press International B.V.
Open Access
This is an open access article under the CC BY-NC license.

Download article (PDF)

<Previous Article In Volume
Next Article In Volume>
Volume Title
Proceedings of the 2nd International Conference on Smart and Innovative Agriculture (ICoSIA 2021)
Series
Advances in Biological Sciences Research
Publication Date
10 March 2022
ISBN
978-94-6239-550-3
ISSN
2468-5747
DOI
10.2991/absr.k.220305.054How to use a DOI?
Copyright
© 2022 The Authors. Published by Atlantis Press International B.V.
Open Access
This is an open access article under the CC BY-NC license.

Cite this article

risenwbib
TY  - CONF
AU  - Aprilianna Putri Zahara Nafsina Luvita Sari
AU  - Akhmad Fathoni
AU  - Heru Sasongko
AU  - Dwi Nur Happy Hariyono
AU  - Dewi Sari Kumalawati
AU  - Dyah Maharani
PY  - 2022
DA  - 2022/03/10
TI  - Genetic Diversity of the Prolactin Gene in Three Indonesian Ducks
BT  - Proceedings of the 2nd International Conference on Smart and Innovative Agriculture (ICoSIA 2021)
PB  - Atlantis Press
SP  - 350
EP  - 354
SN  - 2468-5747
UR  - https://doi.org/10.2991/absr.k.220305.054
DO  - 10.2991/absr.k.220305.054
ID  - Sari2022
ER  -